Posted in Antibodies, Assay Kits, cDNA, Culture Cells, DNA Templates, DNA Testing, Elisa Kits, Equipments, Exosomes, Gels, PCR, Pcr Kits, Peptides, Reagents
Screening of multiclass pesticide residues in honey by SPE-GC/MSD: a pilot study.
The analysis method for monitoring of multiclass pesticide residues (chemical structure variables and chromatographic behavior) in honey has been optimized and in-house validated in this study. Chemical Confirmation of 35 selected pesticides (pesticides and pesticides treated in Hive applied to agricultural practices around Apiaries) have been achieved by extraction of acetonitrile / partition and cleaning by modifying modified EPA solid-phase (SPA) protocol. On the GC / MS pesticide screener Drs.
The extraction procedure applied has provided recovery that can be accepted with related precision (RSD) for chosen pesticides in the range as suggested by Sante on MQL 10 μg KG-1. The potential effect of the matrix for selected analytes is calculated using honey from five different flower sources. Optimized methods are used to determine the level of pesticide residue in honey samples collected randomly from 26 different APIs in Pakistan.
Residue of nine chosen pesticides (diklorvos, mevinphos, ethalflurin, triflurin, lindane, chlorpyrifos-methyl, dieldrin, profenofos, 4,4-DDE) is often detected in a range of 3-48.8 μg kg-1 in 26.9% of The sample analyzed (n = 26) and 15.3% of the sample studied exceeded the maximum residual limit (MRLS). Acaricides, i.e., Coumaphos, Tau-fluvenalate, and Malathion, were not detected in one of the samples of honey analyzed.
Interference exchanges for various hydrocarbons are stunned in part using GC-EI-MSD.
The industrial catalyst process, such as the Fischer-Tropsch process produces various products from Syngas (H2 / CO) such as; Jet fuel, gasoline, diesel, synthetic rubber, monomers for the plastic industry and other oil / candles for special purposes such as cosmetics. Many publications, due to the discovery of the FT process in 1925, has compiled an effort to explain the mechanism.
Many of these publications seek to investigate the FT mechanism with the utilization of certain deuterium experiments through Syngas switching from H2 / CO to D2 / CO. The results of this switching show that hydrogen is involved in limited steps, however; The overall process conversion produces a reverse kinetic isotope effect (IKIE). To confirm the results are not hindered by the physical switch of hydrogen isotopes, further experiments are carried out using the same molar from each of the isotopes competitive (i.e. with molar H2 / D2) / co.
Complications arise from this competitive work because it produces fully exchanged products – all stupied hydrocarbons are partially inseparable by chromatography. Thus, this compound can no longer be separated by chromatography and now requires further separation by the masses. The overall scope for this work is to determine whether a series of paraffin compounds that are partially frustrated, produced by FT, can be analyzed using the EI-MSD without inter-instrumental H / D exchange. The results show that there are no real exchanges on the EI MSD for carbon range from around C6 – C16. Thus, even though the material cannot be separated by chromatographically, they can be separated further and analyzed to determine the entire H / D content for this specific chain length.
Methylation site display (MSD) -aflp, sensitive and affordable method for analysis of CPG methylation profiles.
It has been shown that environmental factors or chemicals can cause developmental diseases. To detect abnormal epigenetic changes in DNA methylation, convenient and cost-effective methods are needed for the study, where some samples are processed simultaneously. We here present the appearance of methylation sites (MSD), unique techniques for DNA library preparation. By combining it with reinforced long fragment length (AFLP) analysis, we developed a new method, MSD-AFLP.

The display library of sites that are monitored only consists of DNA originating from DNA fragments, namely CPG at the end of 5 ‘in the original genomical DNA sample. To test the effectiveness of this method, the level of CPG methylation in the liver, kidney, and mouse hippocampal tissue compared to checking if MSD-AFLP can detect subtle differences in CPG levels that are displaced with specific tissues. As a result, many CPG sites are thought to be specifically different networks detected differently.
The nucleotide sequence adjacent to this metyl-CPG site is identified and we determine the level of methylation with endonuclease methylation restrictions (MSle) –PCR analysis to confirm the accuracy of AFLP analysis. The difference in the level of methylation between networks is almost identical among these methods. With the MSD-AFLP analysis, we detected many CPG showed a statistically significant significant and statistically significant significant difference and a variability rate of less than 10%. In addition, MSD-AFLP analysis can be used to identify CPG methylation sites in other organisms including humans.
Screening with the NMNAT2-MSD platform identifies small molecules that modulate nmnat2 levels in cortical neurons.
Nicotinamide Mononucleotide Adenylyl Transferase 2 (NMNAT2) is a maintenance factor of the main neurons and provides strong neuroprotectors in many preclinical models of neurological disorders. Nmnat2 significantly reduced in Alzheimer’s disease, Huntington, Parkinson. Here we developed a meso-based screening platform (MSD) to calculate endogenous nmnat2 in cortical neurons. High sensitivity and a large dynamic range of the NMNAT2-MSD platform allows us to filter the Lopac Sigma Library consisting of 1280 compounds. This library has a 2.89% hit rate, with 24 positive nmnat2 and 13 negative modulators identified.
Western analysis was carried out to validate and determine the dose of the dependency of the identified modulator. Caffeine, one positive modulator is nmnat2, when it is managed systemicized in the expression of NMNAT2 in RTG4510 mice of tags to normal levels. We confirm in the cell culture model four selected modulators provide special neuroprotectors of nmnat2 to the death of cells induced by Vincristine while four negative modulators are selected to reduce the feasibility of neurons in a way that depends on nmnat2.
ASAH2 Rabbit pAb |
A12596-200ul |
Abclonal |
200 ul |
EUR 459 |
ASAH2 Rabbit pAb |
A12596-20ul |
Abclonal |
20 ul |
EUR 183 |
ASAH2 Rabbit pAb |
A12596-50ul |
Abclonal |
50 ul |
EUR 223 |
ASAH2 Rabbit pAb |
A7985-100ul |
Abclonal |
100 ul |
EUR 308 |
ASAH2 Rabbit pAb |
A7985-200ul |
Abclonal |
200 ul |
EUR 459 |
ASAH2 Rabbit pAb |
A7985-20ul |
Abclonal |
20 ul |
EUR 183 |
ASAH2 Rabbit pAb |
A7985-50ul |
Abclonal |
50 ul |
EUR 223 |
ASAH2 Antibody |
24731-100ul |
SAB |
100ul |
EUR 390 |
ASAH2 antibody |
70R-12124 |
Fitzgerald |
100 ug |
EUR 403 |
Description: Rabbit polyclonal ASAH2 antibody |
ASAH2 Antibody |
36240-100ul |
SAB |
100ul |
EUR 252 |
ASAH2 Antibody |
1-CSB-PA002170EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500 |
ASAH2 Antibody |
1-CSB-PA076840 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
ASAH2 Antibody |
1-CSB-PA133826 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
ASAH2 Polyclonal Antibody, HRP Conjugated |
A62107 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
ASAH2 Polyclonal Antibody, FITC Conjugated |
A62108 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ASAH2 Polyclonal Antibody, Biotin Conjugated |
A62109 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ASAH2 Conjugated Antibody |
C36240 |
SAB |
100ul |
EUR 397 |
ASAH2 siRNA |
20-abx900469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ASAH2 siRNA |
20-abx908269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ASAH2 siRNA |
20-abx908270 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ASAH2 Antibody, HRP conjugated |
1-CSB-PA002170EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ASAH2 Antibody, FITC conjugated |
1-CSB-PA002170EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ASAH2 Antibody, Biotin conjugated |
1-CSB-PA002170ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ASAH2 Blocking Peptide |
33R-10941 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124 |
ASAH2 Blocking Peptide |
3828BP-50 |
Biovision |
|
EUR 153 |
ASAH2 cloning plasmid |
CSB-CL865115HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2181
- Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA
- Show more
|
Description: A cloning plasmid for the ASAH2 gene. |
Mouse ASAH2 shRNA Plasmid |
20-abx974501 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat ASAH2 shRNA Plasmid |
20-abx987160 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ASAH2 shRNA Plasmid |
20-abx961153 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ASAH2 Recombinant Protein (Human) |
RP036760 |
ABM |
100 ug |
Ask for price |
ASAH2 Recombinant Protein (Mouse) |
RP117410 |
ABM |
100 ug |
Ask for price |
ASAH2 Recombinant Protein (Rat) |
RP191108 |
ABM |
100 ug |
Ask for price |
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
20-abx007107 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
abx025039-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
abx025039-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
20-abx214010 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
20-abx214011 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
20-abx177710 |
Abbexa |
|
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
20-abx173712 |
Abbexa |
|
|
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody |
20-abx303129 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP) |
20-abx303130 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC) |
20-abx303131 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin) |
20-abx303132 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Asah2 ORF Vector (Rat) (pORF) |
ORF063704 |
ABM |
1.0 ug DNA |
EUR 506 |
ASAH2 ORF Vector (Human) (pORF) |
ORF012254 |
ABM |
1.0 ug DNA |
EUR 354 |
Asah2 ORF Vector (Mouse) (pORF) |
ORF039138 |
ABM |
1.0 ug DNA |
EUR 506 |
ASAH2 ELISA Kit (Human) (OKCD01831) |
OKCD01831 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL |
Asah2 sgRNA CRISPR Lentivector set (Rat) |
K7087001 |
ABM |
3 x 1.0 ug |
EUR 339 |
ASAH2 sgRNA CRISPR Lentivector set (Human) |
K0130501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Asah2 sgRNA CRISPR Lentivector set (Mouse) |
K3499601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein |
20-abx654471 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM) |
ELI-34287m |
Lifescience Market |
96 Tests |
EUR 865 |
Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM) |
ELI-34330h |
Lifescience Market |
96 Tests |
EUR 824 |
Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM) |
ELI-48960r |
Lifescience Market |
96 Tests |
EUR 886 |
Asah2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7087002 |
ABM |
1.0 ug DNA |
EUR 154 |
Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7087003 |
ABM |
1.0 ug DNA |
EUR 154 |
Asah2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7087004 |
ABM |
1.0 ug DNA |
EUR 154 |
ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0130502 |
ABM |
1.0 ug DNA |
EUR 154 |
ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0130503 |
ABM |
1.0 ug DNA |
EUR 154 |
ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0130504 |
ABM |
1.0 ug DNA |
EUR 154 |
Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3499602 |
ABM |
1.0 ug DNA |
EUR 154 |
Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3499603 |
ABM |
1.0 ug DNA |
EUR 154 |
Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3499604 |
ABM |
1.0 ug DNA |
EUR 154 |
ASAH2 Protein Vector (Mouse) (pPB-C-His) |
PV156550 |
ABM |
500 ng |
EUR 1065 |
ASAH2 Protein Vector (Mouse) (pPB-N-His) |
PV156551 |
ABM |
500 ng |
EUR 1065 |
ASAH2 Protein Vector (Mouse) (pPM-C-HA) |
PV156552 |
ABM |
500 ng |
EUR 1065 |
ASAH2 Protein Vector (Mouse) (pPM-C-His) |
PV156553 |
ABM |
500 ng |
EUR 1065 |
ASAH2 Protein Vector (Rat) (pPB-C-His) |
PV254814 |
ABM |
500 ng |
EUR 1166 |
ASAH2 Protein Vector (Rat) (pPB-N-His) |
PV254815 |
ABM |
500 ng |
EUR 1166 |
ASAH2 Protein Vector (Rat) (pPM-C-HA) |
PV254816 |
ABM |
500 ng |
EUR 1166 |
ASAH2 Protein Vector (Rat) (pPM-C-His) |
PV254817 |
ABM |
500 ng |
EUR 1166 |
ASAH2 Protein Vector (Human) (pPB-His-MBP) |
PV324138 |
ABM |
500 ng |
EUR 481 |
ASAH2 Protein Vector (Human) (pPB-His-GST) |
PV324139 |
ABM |
500 ng |
EUR 481 |
ASAH2 Protein Vector (Human) (pPB-C-His) |
PV049013 |
ABM |
500 ng |
EUR 481 |
ASAH2 Protein Vector (Human) (pPB-N-His) |
PV049014 |
ABM |
500 ng |
EUR 481 |
ASAH2 Protein Vector (Human) (pPM-C-HA) |
PV049015 |
ABM |
500 ng |
EUR 481 |
ASAH2 Protein Vector (Human) (pPM-C-His) |
PV049016 |
ABM |
500 ng |
EUR 329 |
Asah2 3'UTR GFP Stable Cell Line |
TU152183 |
ABM |
1.0 ml |
Ask for price |
Asah2 3'UTR Luciferase Stable Cell Line |
TU102183 |
ABM |
1.0 ml |
Ask for price |
Asah2 3'UTR Luciferase Stable Cell Line |
TU200951 |
ABM |
1.0 ml |
Ask for price |
Asah2 3'UTR GFP Stable Cell Line |
TU250951 |
ABM |
1.0 ml |
Ask for price |
ASAH2 3'UTR GFP Stable Cell Line |
TU051220 |
ABM |
1.0 ml |
EUR 1521 |
ASAH2 3'UTR Luciferase Stable Cell Line |
TU001220 |
ABM |
1.0 ml |
EUR 1521 |
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
20-abx156834 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit |
20-abx494694 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ASAH2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV656977 |
ABM |
1.0 ug DNA |
EUR 1355 |
ASAH2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV656981 |
ABM |
1.0 ug DNA |
EUR 1355 |
ASAH2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV656982 |
ABM |
1.0 ug DNA |
EUR 1355 |
Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit |
QY-E04735 |
Qayee Biotechnology |
96T |
EUR 361 |
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
SEE689Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids. |
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
SEE689Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids. |
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
SEE689Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids. |
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
SEE689Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids. |
Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit |
4-SEE689Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as N-Acylsphingosine Amidohydrolase 2 elisa. Alternative names of the recognized antigen: HNAC1
- non-lysosomal ceramidase
- Neutral ceramidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
Many of the positive modulators of the identified NMNAT2 are predicted to increase the concentration of the camp, indicating that neuronal levels of NMNAT2 are strictly regulated by camp signaling. Taken together, our findings indicate that the NMNAT2-MSD platform provides a sensitive phenotypic screen to detect nmnat2 in neurons.