The analysis method for monitoring of multiclass pesticide residues (chemical structure variables and chromatographic behavior) in honey has been optimized and in-house validated in this study. Chemical Confirmation of 35 selected pesticides (pesticides and pesticides treated in Hive applied to agricultural practices around Apiaries) have been achieved by extraction of acetonitrile / partition and cleaning by modifying modified EPA solid-phase (SPA) protocol. On the GC / MS pesticide screener Drs.

The extraction procedure applied has provided recovery that can be accepted with related precision (RSD) for chosen pesticides in the range as suggested by Sante on MQL 10 μg KG-1. The potential effect of the matrix for selected analytes is calculated using honey from five different flower sources. Optimized methods are used to determine the level of pesticide residue in honey samples collected randomly from 26 different APIs in Pakistan.

Residue of nine chosen pesticides (diklorvos, mevinphos, ethalflurin, triflurin, lindane, chlorpyrifos-methyl, dieldrin, profenofos, 4,4-DDE) is often detected in a range of 3-48.8 μg kg-1 in 26.9% of The sample analyzed (n = 26) and 15.3% of the sample studied exceeded the maximum residual limit (MRLS). Acaricides, i.e., Coumaphos, Tau-fluvenalate, and Malathion, were not detected in one of the samples of honey analyzed.

Interference exchanges for various hydrocarbons are stunned in part using GC-EI-MSD.

The industrial catalyst process, such as the Fischer-Tropsch process produces various products from Syngas (H2 / CO) such as; Jet fuel, gasoline, diesel, synthetic rubber, monomers for the plastic industry and other oil / candles for special purposes such as cosmetics. Many publications, due to the discovery of the FT process in 1925, has compiled an effort to explain the mechanism.

Many of these publications seek to investigate the FT mechanism with the utilization of certain deuterium experiments through Syngas switching from H2 / CO to D2 / CO. The results of this switching show that hydrogen is involved in limited steps, however; The overall process conversion produces a reverse kinetic isotope effect (IKIE). To confirm the results are not hindered by the physical switch of hydrogen isotopes, further experiments are carried out using the same molar from each of the isotopes competitive (i.e. with molar H2 / D2) / co.

Complications arise from this competitive work because it produces fully exchanged products – all stupied hydrocarbons are partially inseparable by chromatography. Thus, this compound can no longer be separated by chromatography and now requires further separation by the masses. The overall scope for this work is to determine whether a series of paraffin compounds that are partially frustrated, produced by FT, can be analyzed using the EI-MSD without inter-instrumental H / D exchange. The results show that there are no real exchanges on the EI MSD for carbon range from around C6 – C16. Thus, even though the material cannot be separated by chromatographically, they can be separated further and analyzed to determine the entire H / D content for this specific chain length.

Methylation site display (MSD) -aflp, sensitive and affordable method for analysis of CPG methylation profiles.

It has been shown that environmental factors or chemicals can cause developmental diseases. To detect abnormal epigenetic changes in DNA methylation, convenient and cost-effective methods are needed for the study, where some samples are processed simultaneously. We here present the appearance of methylation sites (MSD), unique techniques for DNA library preparation. By combining it with reinforced long fragment length (AFLP) analysis, we developed a new method, MSD-AFLP.

The display library of sites that are monitored only consists of DNA originating from DNA fragments, namely CPG at the end of 5 ‘in the original genomical DNA sample. To test the effectiveness of this method, the level of CPG methylation in the liver, kidney, and mouse hippocampal tissue compared to checking if MSD-AFLP can detect subtle differences in CPG levels that are displaced with specific tissues. As a result, many CPG sites are thought to be specifically different networks detected differently.

The nucleotide sequence adjacent to this metyl-CPG site is identified and we determine the level of methylation with endonuclease methylation restrictions (MSle) –PCR analysis to confirm the accuracy of AFLP analysis. The difference in the level of methylation between networks is almost identical among these methods. With the MSD-AFLP analysis, we detected many CPG showed a statistically significant significant and statistically significant significant difference and a variability rate of less than 10%. In addition, MSD-AFLP analysis can be used to identify CPG methylation sites in other organisms including humans.

Screening with the NMNAT2-MSD platform identifies small molecules that modulate nmnat2 levels in cortical neurons.

Nicotinamide Mononucleotide Adenylyl Transferase 2 (NMNAT2) is a maintenance factor of the main neurons and provides strong neuroprotectors in many preclinical models of neurological disorders. Nmnat2 significantly reduced in Alzheimer’s disease, Huntington, Parkinson. Here we developed a meso-based screening platform (MSD) to calculate endogenous nmnat2 in cortical neurons. High sensitivity and a large dynamic range of the NMNAT2-MSD platform allows us to filter the Lopac Sigma Library consisting of 1280 compounds. This library has a 2.89% hit rate, with 24 positive nmnat2 and 13 negative modulators identified.

Western analysis was carried out to validate and determine the dose of the dependency of the identified modulator. Caffeine, one positive modulator is nmnat2, when it is managed systemicized in the expression of NMNAT2 in RTG4510 mice of tags to normal levels. We confirm in the cell culture model four selected modulators provide special neuroprotectors of nmnat2 to the death of cells induced by Vincristine while four negative modulators are selected to reduce the feasibility of neurons in a way that depends on nmnat2.

ASAH2 Rabbit pAb
A12596-200ul	Abclonal	200 ul	EUR 459

ASAH2 Rabbit pAb
A12596-20ul	Abclonal	20 ul	EUR 183

ASAH2 Rabbit pAb
A12596-50ul	Abclonal	50 ul	EUR 223

ASAH2 Rabbit pAb
A7985-100ul	Abclonal	100 ul	EUR 308

ASAH2 Rabbit pAb
A7985-200ul	Abclonal	200 ul	EUR 459

ASAH2 Rabbit pAb
A7985-20ul	Abclonal	20 ul	EUR 183

ASAH2 Rabbit pAb
A7985-50ul	Abclonal	50 ul	EUR 223

ASAH2 Antibody
24731-100ul	SAB	100ul	EUR 390

ASAH2 antibody
70R-12124	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal ASAH2 antibody

ASAH2 Antibody
36240-100ul	SAB	100ul	EUR 252

ASAH2 Antibody
3828-100	Biovision		EUR 316

ASAH2 Antibody
3828-30T	Biovision		EUR 146

ASAH2 Antibody
1-CSB-PA002170EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

ASAH2 Antibody
1-CSB-PA076840	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Antibody
1-CSB-PA133826	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Polyclonal Antibody, HRP Conjugated
A62107	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

ASAH2 Polyclonal Antibody, FITC Conjugated
A62108	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ASAH2 Polyclonal Antibody, Biotin Conjugated
A62109	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

ASAH2 Conjugated Antibody
C36240	SAB	100ul	EUR 397

Anti-ASAH2 antibody
STJ110292	St John's Laboratory	100 µl	EUR 277

Anti-ASAH2 antibody
STJ114470	St John's Laboratory	100 µl	EUR 277

ASAH2 siRNA
20-abx900469	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908269	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908270	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASAH2 Antibody, HRP conjugated
1-CSB-PA002170EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASAH2 Antibody, FITC conjugated
1-CSB-PA002170EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASAH2 Antibody, Biotin conjugated
1-CSB-PA002170ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ASAH2 Blocking Peptide
33R-10941	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124

ASAH2 Blocking Peptide
3828BP-50	Biovision		EUR 153

ASAH2 cloning plasmid
CSB-CL865115HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2181 Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA Show more
Description: A cloning plasmid for the ASAH2 gene.

Mouse ASAH2 shRNA Plasmid
20-abx974501	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat ASAH2 shRNA Plasmid
20-abx987160	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ASAH2 shRNA Plasmid
20-abx961153	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ASAH2 Recombinant Protein (Human)
RP036760	ABM	100 ug	Ask for price

ASAH2 Recombinant Protein (Mouse)
RP117410	ABM	100 ug	Ask for price

ASAH2 Recombinant Protein (Rat)
RP191108	ABM	100 ug	Ask for price

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx007107	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214010	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214011	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx177710	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx173712	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx303129	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP)
20-abx303130	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC)
20-abx303131	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin)
20-abx303132	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asah2 ORF Vector (Rat) (pORF)
ORF063704	ABM	1.0 ug DNA	EUR 506

ASAH2 ORF Vector (Human) (pORF)
ORF012254	ABM	1.0 ug DNA	EUR 354

Asah2 ORF Vector (Mouse) (pORF)
ORF039138	ABM	1.0 ug DNA	EUR 506

ASAH2 ELISA Kit (Human) (OKCD01831)
OKCD01831	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

Asah2 sgRNA CRISPR Lentivector set (Rat)
K7087001	ABM	3 x 1.0 ug	EUR 339

ASAH2 sgRNA CRISPR Lentivector set (Human)
K0130501	ABM	3 x 1.0 ug	EUR 339

Asah2 sgRNA CRISPR Lentivector set (Mouse)
K3499601	ABM	3 x 1.0 ug	EUR 339

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein
20-abx654471	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34287m	Lifescience Market	96 Tests	EUR 865

Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34330h	Lifescience Market	96 Tests	EUR 824

Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-48960r	Lifescience Market	96 Tests	EUR 886

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7087002	ABM	1.0 ug DNA	EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7087003	ABM	1.0 ug DNA	EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7087004	ABM	1.0 ug DNA	EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0130502	ABM	1.0 ug DNA	EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0130503	ABM	1.0 ug DNA	EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0130504	ABM	1.0 ug DNA	EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3499602	ABM	1.0 ug DNA	EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3499603	ABM	1.0 ug DNA	EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3499604	ABM	1.0 ug DNA	EUR 154

ASAH2 Protein Vector (Mouse) (pPB-C-His)
PV156550	ABM	500 ng	EUR 1065

ASAH2 Protein Vector (Mouse) (pPB-N-His)
PV156551	ABM	500 ng	EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-HA)
PV156552	ABM	500 ng	EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-His)
PV156553	ABM	500 ng	EUR 1065

ASAH2 Protein Vector (Rat) (pPB-C-His)
PV254814	ABM	500 ng	EUR 1166

ASAH2 Protein Vector (Rat) (pPB-N-His)
PV254815	ABM	500 ng	EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-HA)
PV254816	ABM	500 ng	EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-His)
PV254817	ABM	500 ng	EUR 1166

ASAH2 Protein Vector (Human) (pPB-His-MBP)
PV324138	ABM	500 ng	EUR 481

ASAH2 Protein Vector (Human) (pPB-His-GST)
PV324139	ABM	500 ng	EUR 481

ASAH2 Protein Vector (Human) (pPB-C-His)
PV049013	ABM	500 ng	EUR 481

ASAH2 Protein Vector (Human) (pPB-N-His)
PV049014	ABM	500 ng	EUR 481

ASAH2 Protein Vector (Human) (pPM-C-HA)
PV049015	ABM	500 ng	EUR 481

ASAH2 Protein Vector (Human) (pPM-C-His)
PV049016	ABM	500 ng	EUR 329

Asah2 3'UTR GFP Stable Cell Line
TU152183	ABM	1.0 ml	Ask for price

Asah2 3'UTR Luciferase Stable Cell Line
TU102183	ABM	1.0 ml	Ask for price

Asah2 3'UTR Luciferase Stable Cell Line
TU200951	ABM	1.0 ml	Ask for price

Asah2 3'UTR GFP Stable Cell Line
TU250951	ABM	1.0 ml	Ask for price

ASAH2 3'UTR GFP Stable Cell Line
TU051220	ABM	1.0 ml	EUR 1521

ASAH2 3'UTR Luciferase Stable Cell Line
TU001220	ABM	1.0 ml	EUR 1521

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
20-abx156834	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit
20-abx494694	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ASAH2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656977	ABM	1.0 ug DNA	EUR 1355

ASAH2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656981	ABM	1.0 ug DNA	EUR 1355

ASAH2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656982	ABM	1.0 ug DNA	EUR 1355

Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit
QY-E04735	Qayee Biotechnology	96T	EUR 361

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Many of the positive modulators of the identified NMNAT2 are predicted to increase the concentration of the camp, indicating that neuronal levels of NMNAT2 are strictly regulated by camp signaling. Taken together, our findings indicate that the NMNAT2-MSD platform provides a sensitive phenotypic screen to detect nmnat2 in neurons.