Quick detection of pesticide residues in wheat has become the priority of the top food security. A headspace free headspace solid-phase microextraction (HS-SPME) has been evaluated for fast filtering of organophosphorus pesticide residues (OPP) in wheat with high sensitivity. Individual wheat samples (1.7 g), barbed with 10 opps, placed in a yellow glass bottle 4 ml and heated at 60 ° C for 45 minutes. During this time, the OPP residue was extracted with 50 μm / 30 μm divinylbenzene (DVB) / Carboxen (car) / plasma polydimethylsiloxane (PDMS) fiber (PDMS) mass spectroscopic from the headspace above the sample.

The fiber was then removed and injected into the GC injection port at 250 ° C for desorption of extracted chemicals. Some residues are identified by the GC mass spectrometer detector (GC-MSD) and quantified with Flame GC Photometric Detector (GC-FPD). Seven spiny levels of 10 OPPS on wheat were analyzed. GC response for DVB / car / PDMS 50 μm / 30 μm fibers increased with increased spiking levels, generating significant (2) >> 0.98) linear regression.

The lowest lods of some pesticide standards are evaluated in conditions of validation studies in various levels of 0 (control) up to 100 ng residues of pesticides per g of wheat separated in the GC Polar (DB Agilent) -35UI capillary column). The results of the HS-SPME method compared to the Quephers AOAC 2007.01 method and they showed several advantages over the latter. This includes increased sensitivity, selectivity and simplicity.

Factors that influence the risk of developing disorders of the lower back musculoskeletal (MSDS) in experienced and inexperienced Rod workers.

The level of injury and dropout during Rodwork training seems to reflect the difficulties faced by an adaptable internship with an increase in physical demands binding slab, one of the tasks of work with the highest risk of injury. Because the experience affects the work strategy, and the result of the risk of developing musculoskeletal disorders (MSDS), this study aims to identify differences in work practices related to binding rebar on slabs, potentially relevant to the development of experienced and inexperienced MSDs.

Fourteen men’s Rodworkers are recruited from experienced (> 2 years of post internship experience), or an inexperienced group (experience <6 months). Both of them bind the area with a rebar placed on the ground. The angular flexion / trunk extension is measured.

The Moment of L4 / L5 is estimated from the EMG spinae t9 erector. Experienced workers are found to spend longer in trunk flexion’s posture, with lower L4 / L5 peak moments. Our findings revealed practices related to each group may have different implications on health back.

Application of industrial level participatory ergonomics approach in developing MSD intervention.

Participatory ergonomics projects are traditionally applied in one organization. In this study, a participatory approach was applied throughout the New Zealand meat processing industry, which involved many organizations and geographical areas. The aim is to develop interventions to reduce the risk of musculoskeletal disorders (MSD). This paper considers the value of the industrial level participatory ergonomics approach to achieving this. The main thinking for participatory approaches includes the need for industrial credibility, and to produce MSD interventions that handle industrial level risk factors.

The industry’s main stakeholder groups become major vehicles for formal participation. This study produces an intervention plan that includes a broader work system and industrial practice. This intervention is fought throughout the industry by the main stakeholder groups and has exceeded research life. While this approach helps meet the research objectives, the existence of the main stakeholder group supported by the industry and the mandate for this initiative is important prerequisites for success.

Factors associated with MSD among construction workers.

Evidence regarding the possibility of risk factors associated with musculoskeletal disorders (MSDS) can guide the selection of possible intervention and employment actions to develop ergonomic steps and appropriate safety. The purpose of this study was to explore the factors related to the development of MSD among construction workers. Nordic Musculoskeletal questionnaire is used to measure severity, duration, frequency and prevalence of symptoms of MSDS in nine areas of the anatomy body.

Physical fitness is assessed based on workers’ answers regarding their own physical fitness perceptions. Psychosocial work demands are measured in terms of work control, psychological demands, social support and job dissatisfaction. Some logistic regression is used to identify the factors associated with the upper msds, neck and upper. The results of several logistic regression show that the MSD limbs are distal related to manual handling, repetition of work, psychosocial demands, job dissatisfaction and gender.

MSD neck, shoulders or upper backs related to manual handling, repetition, psychosocial demands, job dissatisfaction, and physical dissatisfaction. This finding shows that reducing the neck, the upper back of the shoulder and the distal limb to the workplace requires the right steps that aim to make the physical environment more suitable with respect to equipment, machinery, tools and furniture, to reduce repetition, use of strength. and manual handling.

Effect of 12 Week Prop Pilates Training Program (PPEP) in body stability and pain for fruit farmers with MSDS.

The purpose of this study was to determine the possible effects of the 12-week Pilates training program (PPEPP) for fruit farmers (wine, tomatoes, apples) with musculoskeletal (MSD) disorders in stability and body pain. 131 Fruit Farmers with MSD were selected and asked to join the 12-Week Pilates Training Program (PPEP) from 2009 to 2012. Subjects (women = 74, male = 57) aged 50 to 65 years participating voluntarily participating.

Anti-FGF21 antibody
STJ190303	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FGF21

Anti-FGF21 Antibody
A2036-100	Biovision	100 µl	EUR 379

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

anti-FGF21
YF-PA18287	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FGF21

anti-FGF21
YF-PA18288	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FGF21

anti-FGF21
YF-PA18289	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to FGF21

Anti-FGF21 Biotinylated Antibody
A00802-Biotin	BosterBio	50ug/vial	EUR 294

Anti-FGF21 (2F11)
YF-MA11430	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (1A8)
YF-MA11431	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (3G10)
YF-MA11432	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (3A6)
YF-MA11433	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (3E8)
YF-MA11434	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (3E20)
YF-MA20531	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to FGF21

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit
DLR-FGF21-Hu-48T	DL Develop	48T	EUR 355
Should the Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit
DLR-FGF21-Hu-96T	DL Develop	96T	EUR 451
Should the Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit
DLR-FGF21-Mu-48T	DL Develop	48T	EUR 474
Should the Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit
DLR-FGF21-Mu-96T	DL Develop	96T	EUR 614
Should the Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit
DLR-FGF21-p-48T	DL Develop	48T	EUR 538
Should the Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit
DLR-FGF21-p-96T	DL Develop	96T	EUR 703
Should the Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit
DLR-FGF21-Ra-48T	DL Develop	48T	EUR 495
Should the Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit
DLR-FGF21-Ra-96T	DL Develop	96T	EUR 644
Should the Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RD-FGF21-Hu-48Tests	Reddot Biotech	48 Tests	EUR 339

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RD-FGF21-Hu-96Tests	Reddot Biotech	96 Tests	EUR 463

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RD-FGF21-Mu-48Tests	Reddot Biotech	48 Tests	EUR 472

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RD-FGF21-Mu-96Tests	Reddot Biotech	96 Tests	EUR 653

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RD-FGF21-p-48Tests	Reddot Biotech	48 Tests	EUR 545

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RD-FGF21-p-96Tests	Reddot Biotech	96 Tests	EUR 757

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RD-FGF21-Ra-48Tests	Reddot Biotech	48 Tests	EUR 496

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RD-FGF21-Ra-96Tests	Reddot Biotech	96 Tests	EUR 688

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RDR-FGF21-Hu-48Tests	Reddot Biotech	48 Tests	EUR 353

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RDR-FGF21-Hu-96Tests	Reddot Biotech	96 Tests	EUR 483

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RDR-FGF21-Mu-48Tests	Reddot Biotech	48 Tests	EUR 493

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RDR-FGF21-Mu-96Tests	Reddot Biotech	96 Tests	EUR 683

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RDR-FGF21-p-48Tests	Reddot Biotech	48 Tests	EUR 570

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RDR-FGF21-p-96Tests	Reddot Biotech	96 Tests	EUR 793

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RDR-FGF21-Ra-48Tests	Reddot Biotech	48 Tests	EUR 519

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit
RDR-FGF21-Ra-96Tests	Reddot Biotech	96 Tests	EUR 720

Anti-FGF21 Rabbit Monoclonal Antibody
M00802	BosterBio	100ug/vial	EUR 397
Description: Anti-FGF21 Rabbit Monoclonal Antibodytested for IHC, WB in Human, Mouse, Rat

FGF21 Antibody
ABD8947	Lifescience Market	100 ug	EUR 438

FGF21 antibody
70R-6198	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FGF21 antibody raised against the N terminal of FGF21

FGF21 Antibody
36478-100ul	SAB	100ul	EUR 252

FGF21 Antibody
49516-100ul	SAB	100ul	EUR 333

FGF21 Antibody
49516-50ul	SAB	50ul	EUR 239

FGF21 antibody
10R-6940	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody
10R-6941	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody
10R-4103	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody
10R-4104	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody
10R-4106	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody
10R-4108	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody
10R-4111	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody
10R-4112	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody
70R-14210	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal FGF21 antibody

FGF21 Antibody
DF8947	Affbiotech	200ul	EUR 304
Description: FGF21 Antibody detects endogenous levels of total FGF21.

FGF21 Antibody
1-CSB-PA876229	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FGF21 Antibody
1-CSB-PA290047	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

Fgf21 Antibody
1-CSB-PA008627LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf21. Recognizes Fgf21 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

FGF21 Antibody
1-CSB-PA06404A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

FGF21 Conjugated Antibody
C36478	SAB	100ul	EUR 397

FGF21 Conjugated Antibody
C49516	SAB	100ul	EUR 397

FGF21 Polyclonal Antibody
ES9145-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FGF21 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGF21 Polyclonal Antibody
ES9145-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FGF21 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGF21 Polyclonal Antibody
ABP58547-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of FGF21 from Human. This FGF21 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170

FGF21 Polyclonal Antibody
ABP58547-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of FGF21 from Human. This FGF21 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170

FGF21 Polyclonal Antibody
ABP58547-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of FGF21 from Human. This FGF21 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170

Fgf21 Polyclonal Antibody
A62586	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

FGF21 Polyclonal Antibody
A52640	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

FGF21 antibody (biotin)
60R-1444	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FGF21 antibody (biotin)

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

FGF21 siRNA
20-abx916819	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FGF21 siRNA
20-abx916820	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FGF21 protein
80R-4397	Fitzgerald	50 ug	EUR 349
Description: Purified Recombinant FGF21 protein

FGF21 protein
30R-2446	Fitzgerald	10 ug	EUR 352
Description: Purified recombinant Human FGF21 protein

FGF21 protein
30R-2447	Fitzgerald	10 ug	EUR 424
Description: Purified recombinant Mouse FGF21 protein

FGF21 protein
30R-AF039	Fitzgerald	20 ug	EUR 273
Description: Purified recombinant Human FGF21 protein

pET28a-FGF21
PVT14589	Lifescience Market	2 ug	EUR 495

FGF21 recombinant monoclonal antibody
A5710	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human FGF21 for WB ,ELISA

Fgf21 Antibody, HRP conjugated
1-CSB-PA008627LB01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf21. Recognizes Fgf21 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Fgf21 Antibody, FITC conjugated
1-CSB-PA008627LC01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf21. Recognizes Fgf21 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Fgf21 Antibody, Biotin conjugated
1-CSB-PA008627LD01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf21. Recognizes Fgf21 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

FGF21 Antibody, HRP conjugated
1-CSB-PA06404B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FGF21 Antibody, FITC conjugated
1-CSB-PA06404C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FGF21 Antibody, Biotin conjugated
1-CSB-PA06404D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Fgf21 Polyclonal Antibody, HRP Conjugated
A62587	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Fgf21 Polyclonal Antibody, FITC Conjugated
A62588	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Fgf21 Polyclonal Antibody, Biotin Conjugated
A62589	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

FGF21 Polyclonal Antibody, Biotin Conjugated
A52637	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

FGF21 Polyclonal Antibody, FITC Conjugated
A52638	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

FGF21 Polyclonal Antibody, HRP Conjugated
A52639	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

FGF21 cloning plasmid
CSB-CL008627HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 630 Sequence: atggactcggacgagaccgggttcgagcactcagggctgtgggtttctgtgctggctggtcttctgctgggagcctgccaggcacaccccatccctgactccagtcctctcctgcaattcgggggccaagtccggcagcggtacctctacacagatgatgcccagcagacagaagc Show more
Description: A cloning plasmid for the FGF21 gene.

FGF21 Rabbit pAb
A10368-100ul	Abclonal	100 ul	EUR 308

FGF21 Rabbit pAb
A10368-200ul	Abclonal	200 ul	EUR 459

FGF21 Rabbit pAb
A10368-20ul	Abclonal	20 ul	EUR 183

FGF21 Rabbit pAb
A10368-50ul	Abclonal	50 ul	EUR 223

FGF21 Rabbit mAb
A3908-100ul	Abclonal	100 ul	EUR 410

FGF21 Rabbit mAb
A3908-200ul	Abclonal	200 ul	EUR 571

FGF21 Rabbit mAb
A3908-20ul	Abclonal	20 ul	EUR 221

FGF21 Rabbit mAb
A3908-50ul	Abclonal	50 ul	EUR 287

FGF21 Blocking Peptide
33R-2157	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FGF21 antibody, catalog no. 70R-6198

FGF21 Blocking Peptide
DF8947-BP	Affbiotech	1mg	EUR 195

pET28a-FGF21 Plasmid
PVTB00071-1a	Lifescience Market	2 ug	EUR 356

pET28a-FGF21 Plasmid
PVTB00071-1b	Lifescience Market	2 ug	EUR 356

pET28a-FGF21 Plasmid
PVTB00071-1c	Lifescience Market	2 ug	EUR 356

pCMV-SPORT6-FGF21
PVT13987	Lifescience Market	2 ug	EUR 391

pET28a-FGF21 Plasmid
PVT16108	Lifescience Market	2 ug	EUR 325

Fibroblast Growth Factor 21 (FGF21) Antibody
20-abx125845	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fibroblast Growth Factor 21 (FGF21) Antibody
20-abx129878	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fibroblast Growth Factor 21 (FGF21) Antibody
20-abx130212	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fibroblast Growth Factor 21 (FGF21) Antibody
20-abx130325	Abbexa	EUR 328.00 EUR 133.00 EUR 871.00 EUR 453.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fibroblast Growth Factor 21 (FGF21) Antibody
20-abx109786	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

As a result, it was found that medial lateral and anterior-posterior body increased significantly in male and female fruit farmers. It was found that the pain index (VAS) after the 12-week Pilates Prop Program (PPEP) showed a significant decrease.