An Innovative Rapid Method for Analysis of 10 Organophosphorus Pesticide Residues in Wheat by HS-SPME-GC-FPD/MSD.

An Innovative Rapid Method for Analysis of 10 Organophosphorus Pesticide Residues in Wheat by HS-SPME-GC-FPD/MSD.

Quick detection of pesticide residues in wheat has become the priority of the top food security. A headspace free headspace solid-phase microextraction (HS-SPME) has been evaluated for fast filtering of organophosphorus pesticide residues (OPP) in wheat with high sensitivity. Individual wheat samples (1.7 g), barbed with 10 opps, placed in a yellow glass bottle 4 ml and heated at 60 ° C for 45 minutes. During this time, the OPP residue was extracted with 50 μm / 30 μm divinylbenzene (DVB) / Carboxen (car) / plasma polydimethylsiloxane (PDMS) fiber (PDMS) mass spectroscopic from the headspace above the sample.

The fiber was then removed and injected into the GC injection port at 250 ° C for desorption of extracted chemicals. Some residues are identified by the GC mass spectrometer detector (GC-MSD) and quantified with Flame GC Photometric Detector (GC-FPD). Seven spiny levels of 10 OPPS on wheat were analyzed. GC response for DVB / car / PDMS 50 μm / 30 μm fibers increased with increased spiking levels, generating significant (2) >> 0.98) linear regression.

The lowest lods of some pesticide standards are evaluated in conditions of validation studies in various levels of 0 (control) up to 100 ng residues of pesticides per g of wheat separated in the GC Polar (DB Agilent) -35UI capillary column). The results of the HS-SPME method compared to the Quephers AOAC 2007.01 method and they showed several advantages over the latter. This includes increased sensitivity, selectivity and simplicity.

Factors that influence the risk of developing disorders of the lower back musculoskeletal (MSDS) in experienced and inexperienced Rod workers.

The level of injury and dropout during Rodwork training seems to reflect the difficulties faced by an adaptable internship with an increase in physical demands binding slab, one of the tasks of work with the highest risk of injury. Because the experience affects the work strategy, and the result of the risk of developing musculoskeletal disorders (MSDS), this study aims to identify differences in work practices related to binding rebar on slabs, potentially relevant to the development of experienced and inexperienced MSDs.

Fourteen men’s Rodworkers are recruited from experienced (> 2 years of post internship experience), or an inexperienced group (experience <6 months). Both of them bind the area with a rebar placed on the ground. The angular flexion / trunk extension is measured.

The Moment of L4 / L5 is estimated from the EMG spinae t9 erector. Experienced workers are found to spend longer in trunk flexion’s posture, with lower L4 / L5 peak moments. Our findings revealed practices related to each group may have different implications on health back.

Application of industrial level participatory ergonomics approach in developing MSD intervention.

Participatory ergonomics projects are traditionally applied in one organization. In this study, a participatory approach was applied throughout the New Zealand meat processing industry, which involved many organizations and geographical areas. The aim is to develop interventions to reduce the risk of musculoskeletal disorders (MSD). This paper considers the value of the industrial level participatory ergonomics approach to achieving this. The main thinking for participatory approaches includes the need for industrial credibility, and to produce MSD interventions that handle industrial level risk factors.

The industry’s main stakeholder groups become major vehicles for formal participation. This study produces an intervention plan that includes a broader work system and industrial practice. This intervention is fought throughout the industry by the main stakeholder groups and has exceeded research life. While this approach helps meet the research objectives, the existence of the main stakeholder group supported by the industry and the mandate for this initiative is important prerequisites for success.

Factors associated with MSD among construction workers.

Evidence regarding the possibility of risk factors associated with musculoskeletal disorders (MSDS) can guide the selection of possible intervention and employment actions to develop ergonomic steps and appropriate safety. The purpose of this study was to explore the factors related to the development of MSD among construction workers. Nordic Musculoskeletal questionnaire is used to measure severity, duration, frequency and prevalence of symptoms of MSDS in nine areas of the anatomy body.

 An Innovative Rapid Method for Analysis of 10 Organophosphorus Pesticide Residues in Wheat by HS-SPME-GC-FPD/MSD.

Physical fitness is assessed based on workers’ answers regarding their own physical fitness perceptions. Psychosocial work demands are measured in terms of work control, psychological demands, social support and job dissatisfaction. Some logistic regression is used to identify the factors associated with the upper msds, neck and upper. The results of several logistic regression show that the MSD limbs are distal related to manual handling, repetition of work, psychosocial demands, job dissatisfaction and gender.

MSD neck, shoulders or upper backs related to manual handling, repetition, psychosocial demands, job dissatisfaction, and physical dissatisfaction. This finding shows that reducing the neck, the upper back of the shoulder and the distal limb to the workplace requires the right steps that aim to make the physical environment more suitable with respect to equipment, machinery, tools and furniture, to reduce repetition, use of strength. and manual handling.

Effect of 12 Week Prop Pilates Training Program (PPEP) in body stability and pain for fruit farmers with MSDS.

The purpose of this study was to determine the possible effects of the 12-week Pilates training program (PPEPP) for fruit farmers (wine, tomatoes, apples) with musculoskeletal (MSD) disorders in stability and body pain. 131 Fruit Farmers with MSD were selected and asked to join the 12-Week Pilates Training Program (PPEP) from 2009 to 2012. Subjects (women = 74, male = 57) aged 50 to 65 years participating voluntarily participating.

Anti-FGF21 antibody

STJ190303 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FGF21

Anti-FGF21 Antibody

A2036-100 100 µl
EUR 379

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

anti-FGF21

YF-PA18287 50 ul
EUR 363
Description: Mouse polyclonal to FGF21

anti-FGF21

YF-PA18288 50 ug
EUR 363
Description: Mouse polyclonal to FGF21

anti-FGF21

YF-PA18289 100 ug
EUR 403
Description: Rabbit polyclonal to FGF21

Anti-FGF21 Biotinylated Antibody

A00802-Biotin 50ug/vial
EUR 294

Anti-FGF21 (2F11)

YF-MA11430 100 ug
EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (1A8)

YF-MA11431 100 ug
EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (3G10)

YF-MA11432 100 ug
EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (3A6)

YF-MA11433 100 ug
EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (3E8)

YF-MA11434 100 ug
EUR 363
Description: Mouse monoclonal to FGF21

Anti-FGF21 (3E20)

YF-MA20531 200 ul
EUR 363
Description: Mouse monoclonal to FGF21

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit

DLR-FGF21-Hu-48T 48T
EUR 355
  • Should the Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit

DLR-FGF21-Hu-96T 96T
EUR 451
  • Should the Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit

DLR-FGF21-Mu-48T 48T
EUR 474
  • Should the Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit

DLR-FGF21-Mu-96T 96T
EUR 614
  • Should the Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit

DLR-FGF21-p-48T 48T
EUR 538
  • Should the Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit

DLR-FGF21-p-96T 96T
EUR 703
  • Should the Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit

DLR-FGF21-Ra-48T 48T
EUR 495
  • Should the Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit

DLR-FGF21-Ra-96T 96T
EUR 644
  • Should the Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 21 (FGF21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RD-FGF21-Hu-48Tests 48 Tests
EUR 339

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RD-FGF21-Hu-96Tests 96 Tests
EUR 463

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RD-FGF21-Mu-48Tests 48 Tests
EUR 472

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RD-FGF21-Mu-96Tests 96 Tests
EUR 653

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RD-FGF21-p-48Tests 48 Tests
EUR 545

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RD-FGF21-p-96Tests 96 Tests
EUR 757

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RD-FGF21-Ra-48Tests 48 Tests
EUR 496

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RD-FGF21-Ra-96Tests 96 Tests
EUR 688

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RDR-FGF21-Hu-48Tests 48 Tests
EUR 353

Human Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RDR-FGF21-Hu-96Tests 96 Tests
EUR 483

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RDR-FGF21-Mu-48Tests 48 Tests
EUR 493

Mouse Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RDR-FGF21-Mu-96Tests 96 Tests
EUR 683

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RDR-FGF21-p-48Tests 48 Tests
EUR 570

Porcine Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RDR-FGF21-p-96Tests 96 Tests
EUR 793

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RDR-FGF21-Ra-48Tests 48 Tests
EUR 519

Rat Fibroblast Growth Factor 21 (FGF21) ELISA Kit

RDR-FGF21-Ra-96Tests 96 Tests
EUR 720

Anti-FGF21 Rabbit Monoclonal Antibody

M00802 100ug/vial
EUR 397
Description: Anti-FGF21 Rabbit Monoclonal Antibodytested for IHC, WB in Human, Mouse, Rat

FGF21 Antibody

ABD8947 100 ug
EUR 438

FGF21 antibody

70R-6198 50 ug
EUR 467
Description: Rabbit polyclonal FGF21 antibody raised against the N terminal of FGF21

FGF21 Antibody

36478-100ul 100ul
EUR 252

FGF21 Antibody

49516-100ul 100ul
EUR 333

FGF21 Antibody

49516-50ul 50ul
EUR 239

FGF21 antibody

10R-6940 100 ul
EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody

10R-6941 100 ul
EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody

10R-4103 100 ul
EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody

10R-4104 100 ul
EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody

10R-4106 100 ul
EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody

10R-4108 100 ul
EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody

10R-4111 100 ul
EUR 726
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody

10R-4112 100 ul
EUR 691
Description: Mouse monoclonal FGF21 antibody

FGF21 antibody

70R-14210 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal FGF21 antibody

FGF21 Antibody

DF8947 200ul
EUR 304
Description: FGF21 Antibody detects endogenous levels of total FGF21.

FGF21 Antibody

1-CSB-PA876229
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FGF21 Antibody

1-CSB-PA290047
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

Fgf21 Antibody

1-CSB-PA008627LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf21. Recognizes Fgf21 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

FGF21 Antibody

1-CSB-PA06404A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

FGF21 Conjugated Antibody

C36478 100ul
EUR 397

FGF21 Conjugated Antibody

C49516 100ul
EUR 397

FGF21 Polyclonal Antibody

ES9145-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FGF21 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGF21 Polyclonal Antibody

ES9145-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FGF21 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FGF21 Polyclonal Antibody

ABP58547-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of FGF21 from Human. This FGF21 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170

FGF21 Polyclonal Antibody

ABP58547-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of FGF21 from Human. This FGF21 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170

FGF21 Polyclonal Antibody

ABP58547-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of FGF21 from Human. This FGF21 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FGF21 protein at amino acid sequence of 90-170

Fgf21 Polyclonal Antibody

A62586 100 µg
EUR 570.55
Description: fast delivery possible

FGF21 Polyclonal Antibody

A52640 100 µg
EUR 570.55
Description: reagents widely cited

FGF21 antibody (biotin)

60R-1444 100 ug
EUR 327
Description: Rabbit polyclonal FGF21 antibody (biotin)

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

FGF21 siRNA

20-abx916819
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF21 siRNA

20-abx916820
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF21 protein

80R-4397 50 ug
EUR 349
Description: Purified Recombinant FGF21 protein

FGF21 protein

30R-2446 10 ug
EUR 352
Description: Purified recombinant Human FGF21 protein

FGF21 protein

30R-2447 10 ug
EUR 424
Description: Purified recombinant Mouse FGF21 protein

FGF21 protein

30R-AF039 20 ug
EUR 273
Description: Purified recombinant Human FGF21 protein

pET28a-FGF21

PVT14589 2 ug
EUR 495

FGF21 recombinant monoclonal antibody

A5710 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human FGF21 for WB ,ELISA

Fgf21 Antibody, HRP conjugated

1-CSB-PA008627LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf21. Recognizes Fgf21 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Fgf21 Antibody, FITC conjugated

1-CSB-PA008627LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf21. Recognizes Fgf21 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Fgf21 Antibody, Biotin conjugated

1-CSB-PA008627LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf21. Recognizes Fgf21 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

FGF21 Antibody, HRP conjugated

1-CSB-PA06404B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FGF21 Antibody, FITC conjugated

1-CSB-PA06404C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FGF21 Antibody, Biotin conjugated

1-CSB-PA06404D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF21. Recognizes FGF21 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Fgf21 Polyclonal Antibody, HRP Conjugated

A62587 100 µg
EUR 570.55
Description: reagents widely cited

Fgf21 Polyclonal Antibody, FITC Conjugated

A62588 100 µg
EUR 570.55
Description: Ask the seller for details

Fgf21 Polyclonal Antibody, Biotin Conjugated

A62589 100 µg
EUR 570.55
Description: The best epigenetics products

FGF21 Polyclonal Antibody, Biotin Conjugated

A52637 100 µg
EUR 570.55
Description: fast delivery possible

FGF21 Polyclonal Antibody, FITC Conjugated

A52638 100 µg
EUR 570.55
Description: reagents widely cited

FGF21 Polyclonal Antibody, HRP Conjugated

A52639 100 µg
EUR 570.55
Description: Ask the seller for details

FGF21 cloning plasmid

CSB-CL008627HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 630
  • Sequence: atggactcggacgagaccgggttcgagcactcagggctgtgggtttctgtgctggctggtcttctgctgggagcctgccaggcacaccccatccctgactccagtcctctcctgcaattcgggggccaagtccggcagcggtacctctacacagatgatgcccagcagacagaagc
  • Show more
Description: A cloning plasmid for the FGF21 gene.

FGF21 Rabbit pAb

A10368-100ul 100 ul
EUR 308

FGF21 Rabbit pAb

A10368-200ul 200 ul
EUR 459

FGF21 Rabbit pAb

A10368-20ul 20 ul
EUR 183

FGF21 Rabbit pAb

A10368-50ul 50 ul
EUR 223

FGF21 Rabbit mAb

A3908-100ul 100 ul
EUR 410

FGF21 Rabbit mAb

A3908-200ul 200 ul
EUR 571

FGF21 Rabbit mAb

A3908-20ul 20 ul
EUR 221

FGF21 Rabbit mAb

A3908-50ul 50 ul
EUR 287

FGF21 Blocking Peptide

33R-2157 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FGF21 antibody, catalog no. 70R-6198

FGF21 Blocking Peptide

DF8947-BP 1mg
EUR 195

pET28a-FGF21 Plasmid

PVTB00071-1a 2 ug
EUR 356

pET28a-FGF21 Plasmid

PVTB00071-1b 2 ug
EUR 356

pET28a-FGF21 Plasmid

PVTB00071-1c 2 ug
EUR 356

pCMV-SPORT6-FGF21

PVT13987 2 ug
EUR 391

pET28a-FGF21 Plasmid

PVT16108 2 ug
EUR 325

Fibroblast Growth Factor 21 (FGF21) Antibody

20-abx125845
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 21 (FGF21) Antibody

20-abx129878
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 21 (FGF21) Antibody

20-abx130212
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 21 (FGF21) Antibody

20-abx130325
  • EUR 328.00
  • EUR 133.00
  • EUR 871.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 21 (FGF21) Antibody

20-abx109786
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

As a result, it was found that medial lateral and anterior-posterior body increased significantly in male and female fruit farmers. It was found that the pain index (VAS) after the 12-week Pilates Prop Program (PPEP) showed a significant decrease.

Leave A Comment